Information

4.1: Mutation and Polymorphism - Biology

4.1: Mutation and Polymorphism - Biology


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

We have previously noted that an important property of DNA is its fidelity: most of the time it accurately passes the same information from one generation to the next. Changes in DNA sequences are called mutations. If a mutation changes the phenotype of an individual, the individual is said to be a mutant. Naturally occurring, but rare, sequence variants that are clearly different from a normal, wild-type sequence are also called mutations.On the other hand, many naturally occurring variants exist for traits for which no clearly normal type can be defined; thus, we use the term polymorphism to refer to variants of DNA sequences (and other phenotypes) that co-exist in a population at relatively high frequencies (>1%).

Polymorphisms and mutations arise through similar biochemical processes, but the use of the word “polymorphism” avoids implying that any particular allele is more normal or abnormal. For example, a change in a person’s DNA sequence that leads to a disease such as cancer is appropriately called a mutation, but a difference in DNA sequence that explains whether a person has red hair rather than brown or black hair is an example of polymorphism. Molecular markers, which we will discuss in Chapter 9, are a particularly useful type of polymorphism for some areas of genetics research.


Methods for the identification of mitochondrial DNA variants

Claudia Calabrese , . Marcella Attimonelli , in The Human Mitochondrial Genome , 2020

11.2.2.1 Single-strand conformation polymorphism

SSCP allows simultaneous detection of several genomic variants in a large number of samples depending on electrophoretic mobility differences. SSCP is frequently used to detect base substitutions, small deletions, or insertions in the DNA. Radioactive labeled PCR fragments of approximately 200–350 bp are denatured and single strands are separated by nondenaturing polyacrylamide gel electrophoresis. Detection is performed by changes in the DNA mobility [82] . A modified SSCP for mtDNA polymorphism assessment has also been described using a semiautomatic electrophoretic system followed by silver staining [78] . This method is, however, not very informative as it requires complementary confirmation by DNA sequencing for variant identification and has low sensitivity.


Pharmacogenetics

Dopamine and Other Receptor Polymorphisms

Genetic polymorphisms in dopamine receptors have been associated with drug abuse liability and the reinforcing effects of alcohol, cocaine, and nicotine. Genetically variant dopamine receptors are also associated with increased incidence of tardive dyskinesias following long-term treatment of schizophrenia with dopamine receptor antagonists. Schizophrenia is itself a complex set of diseases that is not adequately managed in many patients. Accordingly, both typical and atypical antipsychotic drugs have been found to be effective in some but not all patients with schizophrenia. Genetic polymorphisms in antipsychotic medication receptor targets (dopaminergic, adrenergic, serotoninergic, and/or histaminergic receptor subtypes) have been associated with different clinical responses. Combinations of drug target polymorphisms and drug metabolism variants may eventually form the basis for targeting genetic subgroups of patients with schizophrenia for effective treatment with both typical antipsychotics and newer atypical antipsychotic drugs.


DNA Polymorphisms: Meaning and Classes | Genetics

In this article we will discuss about the meaning an classes of DNA polymorphisms.

Meaning of DNA Polymorphisms:

Different alleles of a gene produce different phenotypes which can be detected by making crosses between parents with different alleles of two or more genes. Then by determining recombinants in the progeny, a genetic map can be deduced.

These are low resolution genetic maps that contain genes with observable phenotypic effects, all mapped to their respective loci. The position of a specific gene, or locus can be found from the map. However, measurements showed that the chromosomal intervals between the mapped genes would contain vast amounts of DNA.

These intervals could not be mapped by the recombinant progeny method because there were no markers in those intervening regions. It became necessary to find additional differential markers or genetic differences that fall in the gaps. This need was met by exploitation of various polymorphic DNA markers.

A DNA polymorphism is a DNA sequence variation that is not associated with any observable phenotypic variation, and can exist anywhere in the genome, not necessarily in a gene. Polymorphism means one of two or more alternative forms (alleles) of a chromosomal region that either has a different nucleotide sequence, or it has variable numbers of tandemly repeated nucleotides.

Thus, it is a site of heterozygosity for any sequence variation. Many DNA polymorphisms are useful for genetic mapping studies, hence they are referred to as DNA markers. DNA markers can be detected on Southern blot hybridisation or by PCR.

The alleles of DNA markers are co-dominant, that is they are neither dominant nor recessive as observed in alleles of most genes. DNA polymorphisms constitute molecularly defined differences between individual human beings.

Classes of DNA Polymorphisms:

There are some major classes of DNA polymorphisms.

1. Single Nucleotide Polymorphisms:

SNP is a single base pair change, a point mutation, and the site is referred to as SNP locus. SNPs are the most common type of DNA polymorphism, occurring with a frequency of one in 350 base pairs, and accounting for more than 90 per cent of DNA sequence variation. The majority of SNPs are found to be present in the non-coding regions of the genome, known as non-coding SNPs. SNPs in the coding regions, that is within genes, are known as coding SNPs (cSNPs).

Detailed studies of cSNPs in humans indicate that each gene has about four cSNPs, half of which resulting in missense mutations in the encoded protein, and half of which produce silent mutations. Whether a cSNP affects a phenotype, depends on the amino acid that is changed by the polymorphism.

About one-half of missense mutations that are SNPs are estimated to cause genetic disease in humans. A non-coding SNP can also affect gene function if it is located in the promoter region or in the gene regulatory region. A small number of SNPs can create a restriction site, or eliminate an already existing restriction site. SNP-induced alterations in restriction sites are detected by using the restriction enzyme followed by Southern blot analysis or PCR.

An individual SNP locus can be analysed by using the technique of allele-specific oligonucleotide (ASO) hybridisation. The search for one particular SNP locus in humans is a challenge, because this is one base pair that is polymorphic out of the three billion base pairs in the human genome.

In the ASO technique, a short oligonucleotide that is complementary to one SNP allele is synthesised and mixed with the target DNA. Hybridisation is performed under high stringency conditions that would allow only a perfect match between probe and the target DNA. That means, the oligonucleotide will not hybridize with target DNA that has any other SNP allele at that locus. Positive result of hybridisation indicates the SNP locus precisely.

A more recent technique of DNA Microarrays can be used for simultaneous typing of hundreds or thousands of SNPs. Details of this technique used for SNPs and genome wide gene expression are described later in this section.

A small number of SNPs can lead to changes in restriction sites either by creating a restriction site or eliminating one. Such SNPs can be detected by using the restriction enzyme for the site, and detection is done by Southern blot analysis or PCR. The different patterns of restriction sites in different genomes yield fragments of different lengths, called restriction fragment length polymorphisms (RFLPs) described below.

2. Restriction Fragment Length Polymorphisms:

RFLPs are restriction enzyme recognition sites that are present in some genomes and absent in others. Consider an organism heterozygous for an RFLP whose genotype we represent as Rr. This organism is backcrossed with another that is homozygous for the RFLP variation allele (rr). Genomic DNA from the progeny of this cross (Rr x rr gives progeny of which 50% is Rr and 50% is rr) is subjected to restriction enzyme digestion, and fragments separated on Southern blots.

The restriction fragments obtained are hybridised with a probe (a cloned DNA fragment) that will distinguish the various genotypes for an RFLP. The probe DNA is unique because it comes from only one DNA segment of the genome and that overlaps the restriction site. A key point of this technique, therefore, is the use of a specific cloned single-copy DNA probe that is specific for an individual marker locus.

Crosses between the positive RFLP organism with other RFLP bearing organisms would yield parental combinations and re-combinations. From the frequency of recombinants, a detailed RFLP map can be produced. RFLPs were the first DNA markers that were in use for characterisation of plant and animal genomes. They have now been replaced by markers based on variation in the number of short tandem repeats (STRs) described below.

3. Short Tandem Repeats:

STRs are also known as microsatellites and simple sequence repeats (SSRs). A tandem repeat is a sequence that is repeated end to end in the same orientation. STRs are 2 to 6 base pair DNA sequences tandemly repeated a few times.

For example, the sequence TCACATCACATCACATCACATCACA is a five-fold repeat of the sequence TCACA. There are dinucleotide, trinucleotide, four-nucleotide, five-nucleotide and six-nucleotide STRs in the human genome.

Microsatellite analysis can be done using a single-copy DNA to serve as a PCR primer pair specific for each marker locus. In contrast with RFLPs that have only one or two alleles in a population, STRs have a much larger number of alleles which can be detected in a population analysis.

Consequently, STRs have a higher proportion of heterozygotes which makes them more suitable for mapping purposes. Polymorphisms in STRs is common in populations which makes them valuable tools in genetic mapping.

4. Variable Number Tandem Repeats:

VNTRs, also called minisatellite markers, the repeat unit is a little larger than in STRs, from seven to a few tens of base pairs long. The VNTR loci in humans are 1 to 5 kilo-base sequences containing repeat units about 15 to 100 nucleotides long. VNTR loci also show polymorphisms. Due to the greater length of VNTR repeats that makes PCR unsuitable, analysis of VNTRs relies on restriction digestion and Southern blotting.

The entire genomic DNA is cut with a restriction enzyme which cuts on either side of the VNTR locus, but does not have a target site within the VNTR arrays, followed by Southern blotting. The VNTR specific probe against a particular repeat sequence of the VNTR locus, will bind at all locations of the repeat sequence in the genome, resulting in a large number of different sized fragments.

The number of tandem repeats is variable from one individual to the other, therefore Southern blot provides a distinct distinguishing pattern of fragments for a single individual. These patterns are also referred to as DNA fingerprints. The technique finds useful application in identification of individuals and in deciding parentage.

5. Microsatellite Markers:

Variable numbers of di-nucleotides repeated in tandem, called microsatellite markers, are dispersed in the genome. The most common type are CA and the complementary GT repeats. Probes are designed for detection of DNA regions surrounding individual microsatellite repeats by using PCR.

The procedure is explained by taking the example of human DNA as follows. Human genomic DNA is subjected to restriction digestion by an enzyme such as Alu l, that will result in fragments about 400 base pairs in length. The fragments are cloned into a vector and Southern blotting is carried out.

To identify genomic inserts that contain CA/GT di-nucleotides, probes specific for these di-nucleotides are used. Sequence of the positive clones is determined, on the basis of which PCR primers are designed that will hybridise with single-copy DNA sequences flanking the specific tandemly repeated microsatellite sequences. PCR amplification is carried out using these primer pairs and genomic DNA.

Thus, if any size variation exists in the stretch of tandemly repeated microsatellite sequence, it would be detected through gel electrophoresis of the DNAs from different individuals. The size variations may differ among the different individuals, all these variations could be determined. A size variation results in amplification product of a different size and represents a marker allele.

6. Randomly Amplified Polymorphic DNA:

RAPDs are based on random PCR amplification. The procedure is carried out by randomly designing primers for PCR which will amplify several different regions of the genome by chance. Such a primer results in amplification of only those DNA regions that have near them, inverted copies of the primer’s own sequence.

The PCR products consist of DNA bands representing different sizes of the amplified DNA. The set of amplified DNA fragments is called randomly amplified polymorphic DNA (RAPD). Certain bands may be unique for an individual and can serve as DNA markers in mapping analysis.


Genetics

Genetic polymorphism

Since all polymorphism has a genetic basis, genetic polymorphism has a particular meaning:

  • Genetic polymorphism is the occurrence together in the same locality of two or more discontinuous forms of a species in such proportions that the rarest of them cannot be maintained just by recurrent mutation [5] . It is sometimes called balancing selection, and is intimately connected with the idea of heterozygote advantage.

The definition has three parts: a) sympatry: one interbreeding population b) discrete forms and c) not maintained just by mutation.

Pleiotropism

Most genes have more than one effect on the phenotype of an organism (pleiotropism). Some of these effects may be visible, and others cryptic, so it is often important to look beyond the most obvious effects of a gene to identify other effects. Cases occur where a gene affects an unimportant visible character, yet a change in fitness is recorded. In such cases the gene's other (cryptic or 'physiological') effects may be responsible for the change in fitness.
"If a neutral trait is pleiotropically linked to an advantageous one, it may emerge because of a proces of natural selection. It was selected but this doesn't mean it is an adaptation. The reason is that, although it was selected, there was no selection for that trait." [13]

Epistasis

Epistasis occurs when the expression of one gene is modified by another gene. For example, gene A only shows its effect when allele B1 (at another locus) is present, but not if B2 is present. This is one of the ways in which two or more genes may combine to produce a co-ordinated change in more than one characters (in, for instance, mimicry). Unlike the supergene, epistatic genes do not need to be closely linked or even on the same chromosome.

Both pleiotropism and epistasis show that a gene need not relate to a character in the simple manner that was once supposed.

The origin of supergenes

Although a polymorphism can be controlled by alleles at a single locus (eg human ABO blood groups), the more complex forms are controlled by several tightly linked genes on a single chromosome. Batesian mimicry in butterflies and heterostyly in angiosperms are good examples. There is a long-standing debate as to how this situation can have arisen, and the question is not yet resolved.

Whereas a gene family (several tighly linked genes performing similar or identical functions) arises by duplication of a single original gene, this is usually not the case with supergenes. In a supergene some of the constituent genes have quite distinct functions, so they must have come together under selection. This process might involve suppression of crossing-over, translocation of chromosome fragments and possibly occasional cistron duplication. That crossing-over can be suppressed by selection has been known for many years. [14] [15]

Debate has tended to centre round the question, could the component genes in a super-gene have started off on separate chromosomes, with subsequent reorganization, or is it necessary for them to start on the same chromosome? Originally, it was held that chromosome rearrangement would play an important role. [16] This explanation was accepted by E.B. Ford and incorporated into his accounts of ecological genetics. [17] [18]

However, today many believe it more likely that the genes start on the same chromosome. [19] They argue that supergenes arose in situ. This is known as Turner's sieve hypothesis. [20] Maynard Smith agreed with this view in his authoritative textbook, [21] but the question is still not definitively settled.


Mutation Vs polymorphism - Mutation Vs polymorphism (Apr/05/2006 )

Its an old question but one that doesnt seem to find a consensus in terms of an answer. i would like to hear what the true definition of mutation Vs polymorphism is.

I need verfication on MY understanding. and if im wrong could i be corrected.Thankyou.

Yes both are changes but is more truthful to explain it as
a mutation: is induced from outside the cell: by an exogenous factor, is inheritable and
does not necessarily harmful to the host. Therefore a mutation is individualised and
will therefore occur in less than 1% of the population.

A polymorphism: is induced from within the cell( i.e. through evolution the cell changes to conform
to the changing environment to survive. (after all the basic function of a cell is to
use all its various pathways and mechanism to surivive and thereby maintaining
its function within the host.)), is heritable but is not necessarily harmful to the
host. This heritable change will occur in at least 1% of the population.

If examples had to be given , which examples will be classified under mutations and which under polymorphism.

The explanation I've been given is that a mutation causes disease whereas a polymorphism does not.

I don't fully agree with you on this one Helena. Maybe it depends on the species you're working on, but I'm working on an RNA virus with a reverse transcription step in its lifecycle. RT has no proofreading activity so there's a lot of random "mutations" in there.

The thing is that due to the large variety in its genome, there's been made up a classification into subtypes (it's HIV-1 group M we're talking about). As you know, there are some antiretroviral compounds used for treatment of HIV-infected people. Without going into detail, these virus in these individuals will get mutations that will cause the virus to be less susceptible to certain drugs (the cause for therapy failure). Now, for certain mutations it is known that they only are "induced" due to therapy in certain subtypes but are omnipresent in other subtypes (and are therefor within this subtype calles "polymorphisms").

A mutation is more like an event. It's something that happens and changes a genome, usually they go unnoticed, sometimes they cause a disease and very rarely they might give a selective advantage and alter evolution.

A polymorphism refers to a variation in genomes in one species. I think its indeed at least 1 % such a variation must occur within a population. As with mutations they might go unnoticed, but they usually have small effects on phenotypes: not as much as mutations. Eg, hair color, enzyme effectiveness, HLA receptors, all kinds of stuff. They might predispose for diseases, eg the APOE (?) and alzheimer.

I don't think the source of the genomic change (so exogenous or endogenous) has something to do with it.

A mutation is more like an event. It's something that happens and changes a genome, usually they go unnoticed, sometimes they cause a disease and very rarely they might give a selective advantage and alter evolution.

A polymorphism refers to a variation in genomes in one species. I think its indeed at least 1 % such a variation must occur within a population. As with mutations they might go unnoticed, but they usually have small effects on phenotypes: not as much as mutations. Eg, hair color, enzyme effectiveness, HLA receptors, all kinds of stuff. They might predispose for diseases, eg the APOE (?) and alzheimer.

I don't think the source of the genomic change (so exogenous or endogenous) has something to do with it.

I agree with David, a mutation is an event that happens once in one individual, either because of an outside source (chemical or radiation or whatever) or just because of a replication mistake. Then, if this mutation is inherited, it might then spread in the population (independently of the fact that is has an influence on the phenotype or not). Then it can be considered as a polymorphism. I would say that the mutation is the event and the polymorphism is the result of this event. I don't know if I am clear.
Valerie

A polymorphism is a mutation that has been proven to have a prevelance above a certain % in a given population

A mutation is a change from the norm/reference, a polymorphism is an excepted norm.
Polymorphisms are genetically past on -spread through the germline by selection or genetic drift- while mutations do not have to.

Dictionaries are not clear on this point. Some specifically define a mutation as a heritable genetic change that is caused by a mutagen, that is, some external agent such as radiation or chemicals. Others are more general and define it only as a heritable genetic change caused by external agents (mutagens) or internal events such as replication errors, unequal crossing-over, gene conversion, etc. Polymorphism seems to me to be a more general term simply meaning "many forms", as the name implies " poly-morphs". My personal internal dictionary identifies mutation as an event, whether it is a point mutation, deletion, insertion, inversion, duplication, whatever, that happens once in an individual and then either disappears if that individual does not breed, or increases in frequency in a population through selection or neutral genetic drift. A polymorphism is simply the state of multiple forms. So, mutations are events that generate polymorphisms.

But can recombination, which can generate new alleles of a gene and therefore polymorphism of that gene, be considered as a mutational event? I think not. So perhaps mutation is only one source of polymorphism.


Symptoms and Etiology of Serious Mental Illness

Carlos W. Pratt , . Melissa M. Roberts , in Psychiatric Rehabilitation (Third Edition) , 2014

Single nucleotide polymorphisms , frequently called SNPs (pronounced “snips”), are the most common type of genetic variation. Each SNP represents a difference in a single DNA building block, called a “nucleotide.” For example, an SNP may replace the nucleotide cytosine (C) with the nucleotide thymine (T) in a certain stretch of DNA. SNPs occur normally throughout a person’s DNA. They occur once in every 300 nucleotides on average, which means there are roughly ten million SNPs in the human genome. Most commonly, these variations are found in the DNA between genes. They can act as biological markers, helping scientists locate genes that are associated with disease. When SNPs occur within a gene or in a regulatory region near a gene, they may play a more direct role in disease by affecting the gene’s function.


4.1: Mutation and Polymorphism - Biology

During the early part of the 20th century after the re-discovery of Mendelian genetics, the accepted picture of the genome was that most organisms, at any given gene locus, are homozygous for a single dominant allele, whose phenotype corresponds to the " wild type " norm for the species, and which is shared with other typical members of the same species. According to this view, the occasional, rare phenotypic variant was arose as a mutation , the large majority of which were regarded as recessive and deleterious. For example, most Drosophila have red eyes: the rare white-eyed fly was regarded as a mutant (" changed ") that arose as a result of a mutation (" change ") in a gene.

In humans, many easily-recognized single-gene traits result in medical conditions such as albinism (absence of skin pigment), polydactyly (extra digits), achondroplasia (stunted limb growth), etc., all of which we tend to put in the category of " diseases ". Thus we tend to think of these rare individuals as " mutants " and therefore " abnormal ," in contrast to the majority of the population who are (like ourselves) " normal ". We tend to associate genetic variants with disease, and view " mutation " as negative. All of these perceptions turn out to be inaccurate. Advances in molecular biology since the late 1960s have shown instead an enormous amount of genetic variation in most species, including our own. At the level of DNA sequences, it is likely that almost everyone is heterozygous at most gene loci, and (except for close relatives) is likely to differ from other members of the population. This being the case, the concept of a standard ' wild type ' as "normal" has no meaning. Observable genetic differences occur as single-nucleotide polymorphisms (SNPs) , alternative base pair differences at particular positions in the gene sequence. The variable effect of such SNP variation on phenotypes is one of the topics of this course. It remains the case that many gene variants do lead to medically deleterious conditions, and a great deal of time, money, and research is invested to understand and ameliorate such conditions.

In modern usage, we avoid the use of ' mutant ' to refer to individual humans (" Queen Victoria was a mutant !"), though we may talk about 'mutant flies'. We also restrict the term ' mutation ' to describe the molecular process by which gene variants are produced (" PKU results from a mutation of the PAH locus "), or to characterize a newly-arisen sequence variant (" a splice-site mutation "). DNA mutation gives rise to SNP variation within populations, however observed SNP differences between any two individuals likely arose at least several (and probably many) generations previously in their ancestors, rather than as a result of mutation in the parental gametes. Rarer cases are genetic variants observed in close relatives, which can often be traced to a particular mutational event in a common ancestor. For example, Hemophilia in the descendants of Queen Victoria is due to a mutation in her germ cells that is seen as a SNP in her (male) descendants. [So far as can be determined, the original mutation in Queen Victoria has died out].

Conscious or unconscious acceptance of inaccurate attitudes about " What is Normal " with respect to genetic variation have led to misinformed social policy, with disastrous consequences. The term " eugenics " was introduced in the late 19th century (prior to any knowledge of genetics) to describe efforts to improve the human species by encouraging breeding of persons with "good genes," as evidenced by superior intelligence, general health, proper social status or (lighter) skin colour, etc. In the absence of any knowledge of genetics, early " positive eugenic " practices were those of livestock breeding, e.g. , that 'like begets like' and persons of 'good stock' should be encourage to breed with others like themselves and hope for the best.

With the rediscovery of Mendel's work on inheritance in peas, many scientists assumed that variation for almost any trait ("Unit Character") could be explained as the result of single-gene Mendelian inheritance. For example, the US Navy in 1919 commissioned a study by the Eugenics Records Office on the genetics of "leadership ability" and "love of the sea" ( thallasophilia ), so as to provide a means of selecting naval cadets on the basis of their pedigrees. Not surprisingly, 'leadership' was found to be dominant, and 'sea lust' recessive and sex-limited, like beard growth (ever see a lady Admiral?). Textbooks showed pedigrees of the JS Bach family to demonstrate inheritance of musical ability, as shown by his multiple talented offspring. State fairs awarded blue-ribbons to 'fitter families' with sturdy, healthy children, in exactly the same way as superior livestock. Such efforts confuse heredity with familiality , the tendency of family members to resemble each other because of their shared environment. For example, boys often follow their fathers into naval and army careers, and the Bach children received music lessons from Dad.

Eugenics unfortunately had its dark side. The massive casualties of World War I were seen in some Western countries as having " negative eugenic " consequences, as officers and soldiers killed tended to be young, physically fit, reproductive males of superior intelligence, leaving behind those unqualified for military service to do the breeding. Studies of certain notorious ' feeble-minded ' and (or) ' criminal ' families (notably, the Kallikaks) concluded that such traits ran in families, as expected for hereditary traits, again ignoring effects of familial poverty, malnutrition, and social stigmatization ('Kallikak' children were habitually shunned).

The popularity of eugenic thinking reinforced post-World War I anti-immigrant sentiment in the US and Canada. With the introduction of IQ tests for educational tracking, low scores of new immigrants were ascribed to their poor genetics, even when the tests were administered in English to non-English-speakers. US Army recruits were administered written IQ exams en masse, where many had never held a pencil. "Negative eugenics" sanctioned by law led to efforts to discourage or actively interfere with the breeding of persons perceived to have " bad genes " . In the 1920s and '30s, many US states and as well as Alberta and British Columbia passed laws permitting compulsory sterilization of thousands of persons with a variety of conditions considered "hereditary" on the basis of little or no evidence (epilepsy, mental retardation, " congenital " criminality or pauperism, etc). The US Supreme Court approved this policy, a leading Justice famously pronouncing, "Three generations of imbeciles are enough'"

The Nazi regime in Germany adopted these same laws, and extended them in 1939 to medically-approved murder of institutionalized persons ( "Lebensunwertes Leben:" Life unworthy of Life ) in its Aktion T4 extermination policy. Technical methods of large-scale execution developed in this program (including gassing) were extended directly to the murder of millions in the Holocaust of the 1940s.

Recommended books include
J Cornwell, " Hitler's Scientists: Science, War, and the Devil's Pact "
C Browning, " The Origin of the Holocaust "
SJ Gould " The Mismeasure of Man ," 2nd ed.


4.1 Chromosomes, Genes, Alleles and Mutations

Sickle Cell Anemia: A Mutation Story from the excellent Evolution Library.

30-Minute Inquiry: Base-substitution mutations

Question: What do HBB, PAH, PKD1, NF1, CFTR, Opn1Mw and HEXA have in common?

Answer: They are all disorders causes by base-substitution mutations.

  1. Assign groups by handing out cards with the codes above (we had already studied HBB, so didn’t include it) and asking them to find each other.
  2. Give them the instructions – to produce a simple poster & 1-minute overview of their disorder, using the guidance in the image below.
  3. Go. Lots of discussion, lots of questioning. If students get stuck, they need to look it up, evaluate their sources and keep on going.
  4. Students will need to use the NCBI gene database to get going: http://www.ncbi.nlm.nih.gov/gene

Check they’re on the right track: HBB (sickle cell), PAH (PKU), PKD1 (polycystic kidney disease), NF1 (neurofibromatosis), CFTR (cystic fibrosis), Opn1Mw (medium-wave sensitive colour-blindness), HEXA (Tay-Sachs disease).


Mutation Vs polymorphism - Mutation Vs Polymorphism (Apr/05/2006 )

its an old question, but one that does not seem to have a consensus in terms of a precise definition. What is the difference between polymorphism Vs mutation?

I need verification to MY understanding.. and if im wrong could i be corrected please. THankyou

Yes both are changes but is it more truthful to explain it as:

a mutation: is induced from outside the cell: by an exogenous factor, is inheritable and
will not necessarily be harmful to the host. Therefore a mutation is individualised and
will occur in less than 1% of the population.

A polymorphism: is induced from within the cell( i.e. through evolution the cell changes to conform
to the changing environment to survive. (after all the basic function of a cell is to
use all its various pathways and mechanism to survive, thereby maintaining
its function within the host.)), is heritable but is not necessarily harmful to the
host. This heritable change will occur in at least 1% of the population.

If examples had to be given , which examples will be classified under mutations and which under polymorphism.

in a nut shell "yes": the key point is the prevalance in the population, polymorphisms are those found in a significant proportion of the population, whereas mutations are not.

I've been recently informed that according to Nature Genetics, it is the prevelance in a population thats the key, along with its disease causing tendencies.

Just to make a pedantic point, polymorphisms can also be inherited and associated with disease, but cannot directly cause the disease

I've been recently informed that according to Nature Genetics, it is the prevelance in a population thats the key, along with its disease causing tendencies.

Just to make a pedantic point, polymorphisms can also be inherited and associated with disease, but cannot directly cause the disease

So if i were to ask you to classify the following individually : cancer ,sickle cell anemia, P53 genetic change. would these three types of disease be classifed individually as a polymorphism or mutation.

Again it come down to frequency in the population, cancerous mutations (even common one such as BRAC-1) occur in less than 1% of the population, therefore most diseases are associated with the term mutations - as it is higly unlikely that a disease causing mutation will persist in more than 1% of the population.

While the term polymorphisms is normally associated with other inherited factors that either are beneficial or null, as you would expect these polymorphisms can easily occur in over 1% of the population.

Thus in the end the prevelence of the mutation in the population decides what term is given - but i would say you are safe to associate diseases with mutations.

And interesting aside, would be in a population subset where a disease causing mutation actually confers an advantage and thus occurs at higer levels in the population ie. over 1% such as some areas in africa where sickle cell anemia confers resistance to malaria, in this case well I believe it will be a polymorphism as by definition it occurs in over 1% of the population

In popgen, a mutation is described as a one time single event, while a polymorphism is a mutation that was able to increase in frequency within the population..
More precisely, if the frequency of appearance of the "variant" is higher that neutral equilibrium population mutation rate, it is a polymorphism.